Review



single-guide rna plasmid ligated into bbsi-digested phu6-grna  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Addgene inc single-guide rna plasmid ligated into bbsi-digested phu6-grna
    Single Guide Rna Plasmid Ligated Into Bbsi Digested Phu6 Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single-guide rna plasmid ligated into bbsi-digested phu6-grna/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    single-guide rna plasmid ligated into bbsi-digested phu6-grna - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    390 oligonucleotides guide rnas  (ATCC)
    94
    ATCC 390 oligonucleotides guide rnas
    390 Oligonucleotides Guide Rnas, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/390 oligonucleotides guide rnas/product/ATCC
    Average 94 stars, based on 1 article reviews
    390 oligonucleotides guide rnas - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    annealed guide rnas  (New England Biolabs)
    99
    New England Biolabs annealed guide rnas
    Annealed Guide Rnas, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/annealed guide rnas/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    annealed guide rnas - by Bioz Stars, 2026-03
    99/100 stars
    		  Buy from Supplier
    single-guide rna plasmid ligated into bbsi-digested phu6-grna  (Addgene inc)
    90
    Addgene inc single-guide rna plasmid ligated into bbsi-digested phu6-grna
    Single Guide Rna Plasmid Ligated Into Bbsi Digested Phu6 Grna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single-guide rna plasmid ligated into bbsi-digested phu6-grna/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    single-guide rna plasmid ligated into bbsi-digested phu6-grna - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    lvs expressing crispr/cas9 and guide rnas (grnas)  (VectorBuilder GmbH)
    90
    VectorBuilder GmbH lvs expressing crispr/cas9 and guide rnas (grnas)
    Lvs Expressing Crispr/Cas9 And Guide Rnas (Grnas), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lvs expressing crispr/cas9 and guide rnas (grnas)/product/VectorBuilder GmbH
    Average 90 stars, based on 1 article reviews
    lvs expressing crispr/cas9 and guide rnas (grnas) - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    tigit-targeting guide rnas (grna) t45 ugugccugucaucauuccua  (Synthego Inc)
    90
    Synthego Inc tigit-targeting guide rnas (grna) t45 ugugccugucaucauuccua
    Tigit Targeting Guide Rnas (Grna) T45 Ugugccugucaucauuccua, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tigit-targeting guide rnas (grna) t45 ugugccugucaucauuccua/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    tigit-targeting guide rnas (grna) t45 ugugccugucaucauuccua - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    guide rnas grnas  (Addgene inc)
    94
    Addgene inc guide rnas grnas
    Guide Rnas Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rnas grnas/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    guide rnas grnas - by Bioz Stars, 2026-03
    94/100 stars
    		  Buy from Supplier
    guide rnas targeting lmnb1 5  (Addgene inc)
    93
    Addgene inc guide rnas targeting lmnb1 5
    Guide Rnas Targeting Lmnb1 5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rnas targeting lmnb1 5/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    guide rnas targeting lmnb1 5 - by Bioz Stars, 2026-03
    93/100 stars
    		  Buy from Supplier
    guide rna grna  (New England Biolabs)
    96
    New England Biolabs guide rna grna
    Guide Rna Grna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rna grna/product/New England Biolabs
    Average 96 stars, based on 1 article reviews
    guide rna grna - by Bioz Stars, 2026-03
    96/100 stars
    		  Buy from Supplier
    guide rnas (grnas) synthego gene knockout kit  (Synthego Inc)
    90
    Synthego Inc guide rnas (grnas) synthego gene knockout kit
    Guide Rnas (Grnas) Synthego Gene Knockout Kit, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/guide rnas (grnas) synthego gene knockout kit/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    guide rnas (grnas) synthego gene knockout kit - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    plasmids containing dcas13b-m3 and guide rna (grna)  (Synbio Technologies LLC)
    90
    Synbio Technologies LLC plasmids containing dcas13b-m3 and guide rna (grna)
    Plasmids Containing Dcas13b M3 And Guide Rna (Grna), supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmids containing dcas13b-m3 and guide rna (grna)/product/Synbio Technologies LLC
    Average 90 stars, based on 1 article reviews
    plasmids containing dcas13b-m3 and guide rna (grna) - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results